Sunday, December 18, 2016

A large palindrome in Mycobacterium leprae

I have found a number of sizable palindromes in Mycobacterium leprae Br4923. I report two here.

The larger one is 74 bases long:

GGTGCTTGTTTTGCAATCTCGACCATTACCTGGCCTTAAGGCCAGGTAATGGTCGAGATTGCAAAACAAGCACC

This is a true palindrome (in that the reverse complement of the sequence exactly equals the sequence). It occurs precisely once (hence is not a CRISPR) in pseudogene MLBr01586, which appears to be an analog of M. tuberculosis soluble secreted antigen MPT53. The pseudogene in question, of length 489 bases, is flanked on one side by a pseudogene that appears to be an analog of a 23S rRNA methyltransferase, and on the other side by a pseudogene that is an analog of a putative "integral membrane protein."

MLBr01586 has a G+C content of 56.4%. The pseudogenes on either side of it have G+C contents of 59% and 60%.

The palindrome is long enough to fold back on itself to produce a hairpin-like secondary structure of substantial size. Its function, if any, is of course unknown.

A palindrome of length 60 can be found in pseudogene MLBr00038:

TACCTTGGTTAGGGCATAGCCGCTGTGCAGCTGCACAGCGGCTATGCCCTAACCAAGGTA

MLBr00038 has a G+C content of only 47% and appears to be an analog of Type VII secretion protein EccE from Mycobacterium malmoense (and others), which has a G+C content of 72%.

The rather advanced AT shift of the pseudogenes is consistent with runaway accumulation of random mutations. The existence of long, intact palindromes in the midst of such mutational mayhem is surprising, leading one to wonder whether secondary structure is preferentially conserved in pseudogenes, even as codons degrade. Indeed, maybe that's one reason why the pseudogenes continue to exist after an estimated 9 to 20 million years. Their secondary structures are needed.

80 comments:

  1. Packers and Movers Bangalore for 100% Affordable and Professional Packers and Movers in Bangalore. Compare Charges of Movers and Packers, Household Shifting Services at. Packers And Movers Bangalore

    ReplyDelete
  2. Packers and Movers Bangalore for 100% Affordable and Professional Packers and Movers in Bangalore. Compare Charges of Movers and Packers, Household Shifting Services at. Packers And Movers Bangalore

    ReplyDelete
  3. An awesome post “thanks” for mentioning YOUR BRAND in your excellent article.
    Cochin Shipyard Recruitment 2017

    ReplyDelete
  4. I must say you had done a tremendous job,I appreciate all your efforts.Thanks alot for your writings......Waiting for a new 1...Please visit our wonderful and valuable website:
    Packers And Movers Chennai

    ReplyDelete
  5. Thanks for this blog. provided great information. All the details are explained clearly with the great explanation. Thanks for this wonderful blog. Step by step processes execution are given clearly.Know the details about different thing.
    Latest Jharkhand Govt jobs

    ReplyDelete
  6. Really Good blog post.provided a helpful information.I hope that you will post more updates like this.
    Navy jobs 2017-18

    ReplyDelete
  7. Good post and thanks for the information shared and this make me to visit your portal again, also checkout Bank job updates

    ReplyDelete
  8. Excellent Post...I must thank you for this informative news....
    This is my first time go to see at here and i am really pleassant to read
    all at one place
    Packers and Movers Mumbai

    ReplyDelete
  9. Excellent Post...I must thank you for this informative news....
    This is my first time go to see at here and i am really pleassant to read
    all at one place
    Packers and Movers Mumbai
    Packers And Movers Mumbai to Hyderabad

    ReplyDelete
  10. Thank for the good topic,Thanks for your sharing.

    ดูหนังออนไลน์

    ReplyDelete
  11. Hey, you now can download writing apps for ipads here and use them to benefit your writing skills!

    ReplyDelete
  12. You indicated elsewhere regarding the war on cancer: approximately $500 billion in 2012 dollars spent since Nixon declared war, at http://bigthink.com/devil-in-the-data/the-never-ending-war-on-cancer. Just wondering where you got this statistic (I would like to cite it for a research paper). Thanks. Nat Pernick, NatPernick@gmail.com (I cannot find another way to contact you other than this comment)

    ReplyDelete
  13. This is the most interesting information and fit into our topic.obat amandel and obat luka diabetes and cara menghilangkan miom di rahim and walatra gamat emas kapsul

    ReplyDelete
  14. really a vry nice blog i really appreciate all your efforts ,thank you so mch for sharing this valuable information with all of us
    Packers And Movers Bangalore

    ReplyDelete
  15. I appreciate this post and its seems looking so informative Thanks for sharing with us..
    Packers And Movers in Bangalore

    ReplyDelete

  16. really a vry nice blog i really appreciate all your efforts ,thank you so mch for sharing this valuable information with all of us
    Packers And Movers Hyderabad

    ReplyDelete
  17. Really a vry nice blog i really appreciate all your efforts ,thank you so mch for sharing this valuable information with all of us
    Packers And Movers Hyderabad

    ReplyDelete
  18. The blog are the best that is extremely useful to keep.

    หนังผี

    ReplyDelete
  19. Thank you to tell us so much useful information. I’m glad to read it.
    Heart Surgery in Ranchi

    ReplyDelete
  20. Really impressive post. I read it whole and going to share it with my social circules. I enjoyed your article and planning to rewrite it on my own blog.
    Packers And Movers Mumbai


    ReplyDelete
  21. This comment has been removed by the author.

    ReplyDelete
  22. List of Packers And Movers Bangalore Local Shifting Charges Approx. Hire Cheap And Best Rate For Packers And Movers Bangalore With Approx Charges, Review And Rating For Local House Shifting Services.
    @ Packers And Movers Bangalore Local Shifting Charges Approx

    ReplyDelete
  23. Great post but I was wondering if you could write a little more on this subject. I’d be very thankful if you could elaborate a little bit further. Thanks in advance! article writing services, business writing services

    ReplyDelete
  24. Thank for providing good information for site,Thanks for your sharing.

    หนังออนไลน์

    ReplyDelete
  25. Shivshakti is one of the best Packers and Movers for House Shifting Services in Hyderabad, Office, Local Shifting, Relocation and all other Transport Services. Particularly packing and moving industries is very price sensitive and are market-oriented. Packers and Movers in Hyderabad

    ReplyDelete
  26. I am really enjoying reading your well written articles. I think you spend numerous effort and time updating your blog.Packers And Movers Mumbai

    ReplyDelete
  27. An awesome blog thanks a lot for giving me this great opportunity to write on this please visit our website I assure you that it will be very useful for you Packers And Movers Pune

    ReplyDelete
  28. Lovely Website, Maintain the fantastic work. Thank you so much!
    We Provide Best Packers And Movers chennai List for Get Free Best Quotes, Compare Charges, Save Money And Time, Household Shifting Services @ Packers And Movers Chennai

    ReplyDelete
  29. Hy Admin,
    Wow wonderful post you sharing..
    Packers and Movers Agra Provide Door to door services with affordable price. If you want to shifting your house or moving the luggage so please contact me. For more information visit our site. http://www.packersandmoversagra.com/
    Packers and Movers firozabad
    Packers and Movers Mainpuri
    #packersandmoversagra #packersandmoversdelhi #packersandmoversfirozabad #packersandmoversmainpuri

    #Packers and #Movers #Agra
    vanshpackers.agra@gmail.com
    Call Us :- +91-9675774777, 8006720005, 9627006767

    ReplyDelete
  30. Hello guest,
    Thanks for sharing this Amazing post,
    Packers and Movers Delhi provide the best way for the people to householding and shifting. Packers and movers do work with safe hands and very easily..For more information visit our site. http://www.packersandmoversagra.com/
    Packers and Movers Lucknow
    Packers and Movers Delhi
    #packersandmoversagra #packersandmoversdelhi #packersandmoversnoida #packersandmoverslucknow

    #Packers and #Movers #Agra
    vanshpackers.agra@gmail.com
    Call Us :- +91-9675774777, 8006720005, 9627006767

    ReplyDelete
  31. Very well written information. It will be beneficial i really appreciate all your efforts ,thank you so mch for sharing this valuable information with all of us.Packers And Movers Gurgaon

    ReplyDelete
  32. I am bold enough among many others to state that there is now a potent cure to this sickness but many are unaware of it. I discovered that I was infected with the virus 3 months ago, after a medical check-up. My doctor told me and I was shocked, confused and felt like my world has crumbled. I was dying slowly due to the announcement of my medical practitioner but he assured me that I could leave a normal life if I took my medications (as there was no medically known cure to Herpes). I went from churches to churches but soon found that my case needed urgent attention as I was growing lean due to fear of dying anytime soon. In a bid to look for a lasting solution to my predicament, I sought for solutions from the herbal world. I went online and searched for every powerful trado-medical practitioner that I could severe, cos I heard that the African Herbs had a cure to the Herpes syndrome. It was after a little time searching the web that I came across one Dr Itua(A powerful African Herbal Doctor), who offered to help me at a monetary fee. I had to comply as this was my final bus-stop to receiving a perfect healing. My last resolve was to take my life by myself, should this plan fail. At last it worked out well. He gave me some steps to follow and I meticulously carried out all his instructions. Last month, to be precise, I went back to the hospital to conduct another test and to my amazement, the results showed that negative,Dr Itua Can As Well Cure The Following Desease…Cancer,Hiv,Herpes, Hepatitis B,Liver Inflammatory,Diabetis,Fribroid, Dercum,Get Your Ex Back, You can free yourself of this Herpes virus by consulting this great African Herbal Doctor via this e-mail: drituaherbalcenter@gmail.com or call and whatsapp him on +2348149277967 He will help you and his herb medication is sure. he has the cure on all disease .You can talk to me on INSTAGRAM..tashamoore219....

    ReplyDelete
  33. Get All the Latest Jobs Updates Indians Jobs No 1 Site All Latest India Jobs Portal

    ReplyDelete
  34. tgjobsnews is the top most job websiteAll India Central Govt Jobs

    ReplyDelete
  35. Packers And Movers Chennai Local Household Shifting Service, Get Free Best Price Quotes Local Packers and Movers in Chennai List, Compare Charges, Save Money And Time.
    Packers And Movers In Chennai Local

    ReplyDelete
  36. Terimakasih artikel yang baik dan sangat informatif, saya ingin mengikutinya.... kunjungi juga blog saya

    Obat Wasir
    Cara Mengobati Ambeien
    Obat BAB Berdarah
    Obat Benjolan Di Anus
    Obat Ambeien

    ReplyDelete
  37. It was during my research on HIV/Herpes that I stumbled upon the Hiv/Herpes information; information which is quite easy to find when doing a search for STD on google. I was into conspiracy at the time thought of HIV/Herpes Cured' being a conspiracy was something Ignorance though,I found pretty interesting about herbal medicine. I asked questions about the Herbal cure's on official HIV/Herpes websites and I was banned for doing so by moderators who told me that I was parroting Hiv/Herpes propaganda. This reinforced my belief that there is a cure for Hiv/Herpes Then i found a lady from germany name Achima Abelard Dr Itua Cure her Hiv so I send him a mail about my situation then talk more about it and send me his herbal medicine I drank for two weeks.And today I'm Cured no Hiv/Herpes in my life,I searched for Hiv/Herpes groups to attempt to make contact with people in order to learn more about Hiv/Herpes Herbal Cure's I believed at this time that you with the same disease this information is helpful to you and I wanted to do the best I could to spread this information in the hopes of helping other people.That Dr Itua cure Hiv,Herpes,Hepatitis,Diabetes,Copd,Fibroid,Als, And Cancer. He's a herbal doctor with a unique heart of God, Contact Emal..drituaherbalcenter@gmail.com Phone or whatsapp..+2348149277967.

    ReplyDelete
  38. http://bookourshifting.in/packers-and-movers-electronic-city-bangalore - Hire trusted and affordable movers and packers best quality packing for your home shifting, office relocation, car carriers, bike transportation services within Bangalore locality. Contact us for further details

    ReplyDelete
  39. Hire Manish Packers and Movers Pvt Ltd in India for hassle-free Household Shifting, Office Relocation, Car Transportation, Loading Unloading, packing Unpacking at affordable Price Quotation. Top Rated Safe and Secure Service Providers who can help you with 24x7 and make sure a Untroubled Relocation Services at Cheapest/Lowest Rate. Visit More :-
    Manish Packers and Movers Pvt Ltd
    Packers and Movers Bangalore
    Packers and Movers Gurgaon
    Packers and Movers Indore
    Packers and Movers Kolkata
    Packers and Movers Mumbai
    Packers and Movers Nagpur
    Packers and Movers Ahmedabad
    Manish Packers in Indore
    Manish Packers and Movers Pvt Ltd Sitemap

    ReplyDelete

  40. Manish Packers and Movers Pvt Ltd as a Services providing company can make all the difference to your Home Relocation experience. Indore based Company which offers versatile solutions, Right team that easily reduce the stress associated with a Household Shifting, Vehicle Transportation. we help things run smoothly and reduce breakages and offer you seamless, Affordable, Reliable Shifting Services, Compare Shifting Charges, Visit :
    Manish Packers and Movers Ptv Ltd @ https://www.manishpackersmoversindore.in/
    Packers and Movers Indore @ https://www.manishpackersmoversindore.in/packers-and-movers-indore.html
    Manish Packers Indore @ https://www.manishpackersmoversindore.in/manish-packers-and-movers-indore.html
    Packers and Movers Gurgaon @ https://www.manishpackersmoversindore.in/packers-movers-gurgaon.html
    Packers and Movers Kolkata @ https://www.manishpackersmoversindore.in/packers-movers-kolkata.html
    Packers and Movers Mumbai @ https://www.manishpackersmoversindore.in/packers-movers-mumbai.html
    Packers and Movers Bhopal @ https://www.manishpackersmoversindore.in/packers-movers-bhopal.html
    Packers and Movers Nagpur @ https://www.manishpackersmoversindore.in/packers-movers-nagpur.html
    Packers and Movers Raipur @ https://www.manishpackersmoversindore.in/packers-movers-raipur.html
    Packers and Movers Ahmedabad @ https://www.manishpackersmoversindore.in/packers-movers-ahmedabad.html

    ReplyDelete
  41. Thanks for your valuable information. It really gives me an insight on this topic. I'll visit here again for more information.

    moving companies in florida

    ReplyDelete
  42. Packers and Movers Chennai
    #Packers and Movers Chennai have already carved a special place in the hearts of thousands of satisfied customers. at, DHL Cargo Packers Movers Quality service and values have been the driving force behind our remarkable growth.

    ReplyDelete
  43. myTectra Placement Portal is a Web based portal brings Potentials Employers and myTectra Candidates on a common platform for placement assistance

    ReplyDelete
  44. Thanks for sharing such an informative information with us it helps us to finding a perfect team of movers. We also provide packing and moving services in Delhi and in entire India at BEST Price and with perfection.

    Packers and Movers in Delhi
    Packers And Movers In Delhi
    Packers And Movers In Gurgaon
    Packers and Movers
    Packers And Movers In Noida
    Packers And Movers In Greater Noida
    Packers And Movers In Dwarka Delhi
    Packers And Movers In Rohini Delhi

    ReplyDelete
  45. Packers and Movers ChennaiIn most cases, professional packers and movers are listed in the top service vendors when it comes to listing top packers and vendors.

    ReplyDelete
  46. Hi,

    First of all thank you so much for sharing this post. You provide the best information for movers. Get more details:

    Packers & Movers in India.

    Packers & Movers In Bangalore.

    ReplyDelete
  47. Latest Internship Jobs Updates Jobs portal Fresher Internship Jobs Updates

    ReplyDelete
  48. Nice Post. If you are looking for best packing and moving services in bangalore, try Gooezy

    ReplyDelete
  49. Thanks for sharing this kind of useful information Xpressmove offers best service.
    For More Information. Click here

    ReplyDelete

Add a comment. Registration required because trolls.