I have found a number of sizable palindromes in Mycobacterium leprae Br4923. I report two here.
The larger one is 74 bases long:
GGTGCTTGTTTTGCAATCTCGACCATTACCTGGCCTTAAGGCCAGGTAATGGTCGAGATTGCAAAACAAGCACC
This is a true palindrome (in that the reverse complement of the sequence exactly equals the sequence). It occurs precisely once (hence is not a CRISPR) in pseudogene MLBr01586, which appears to be an analog of M. tuberculosis soluble secreted antigen MPT53. The pseudogene in question, of length 489 bases, is flanked on one side by a pseudogene that appears to be an analog of a 23S rRNA methyltransferase, and on the other side by a pseudogene that is an analog of a putative "integral membrane protein."
MLBr01586 has a G+C content of 56.4%. The pseudogenes on either side of it have G+C contents of 59% and 60%.
The palindrome is long enough to fold back on itself to produce a hairpin-like secondary structure of substantial size. Its function, if any, is of course unknown.
A palindrome of length 60 can be found in pseudogene MLBr00038:
TACCTTGGTTAGGGCATAGCCGCTGTGCAGCTGCACAGCGGCTATGCCCTAACCAAGGTA
MLBr00038 has a G+C content of only 47% and appears to be an analog of Type VII secretion protein EccE from Mycobacterium malmoense (and others), which has a G+C content of 72%.
The rather advanced AT shift of the pseudogenes is consistent with runaway accumulation of random mutations. The existence of long, intact palindromes in the midst of such mutational mayhem is surprising, leading one to wonder whether secondary structure is preferentially conserved in pseudogenes, even as codons degrade. Indeed, maybe that's one reason why the pseudogenes continue to exist after an estimated 9 to 20 million years. Their secondary structures are needed.
Sunday, December 18, 2016
Friday, June 17, 2016
Friday Water Cooler
The Media Is an Arm of the Ruling Class of This Country (huffingtonpost.com).You're being fed information from just a handful of companies. See illustration below.
Modern mussell shells are much thinner than 50 years ago (phys.org). Because of acidification.
Should We Sequence the DNA of Every Cancer Patient? (technologyreview.com). Boiling the ocean is seldom a good approach, and probably won't be good here either.
New Device Sold on the Dark Web Can Clone Up to 15 Contactless Cards per Second (news.softpedia.com/news). Imagine a crook with one of these just strolling through a crowded subway station, sniffing out card details...
Why Philosophers Should Care About Computational Complexity (scottaaronson.com).
Home Depot Files Antitrust Lawsuit Against Visa, MasterCard (ajc.com).
US Recession Odds Hit 55% According to Deutsche Bank Model (mishtalk.com).
That Time I Went To A Trump Rally (storify.com). Berntards, listen up!
44 Percent of Democrats Want Sanders to Make an Independent Run for the White House (defenddemocracy.press).
Chin Up (carlbeijer.com).
Buy my books (or at least click for more info):
![]() |
| Click to enrage. |
Should We Sequence the DNA of Every Cancer Patient? (technologyreview.com). Boiling the ocean is seldom a good approach, and probably won't be good here either.
New Device Sold on the Dark Web Can Clone Up to 15 Contactless Cards per Second (news.softpedia.com/news). Imagine a crook with one of these just strolling through a crowded subway station, sniffing out card details...
Why Philosophers Should Care About Computational Complexity (scottaaronson.com).
Home Depot Files Antitrust Lawsuit Against Visa, MasterCard (ajc.com).
US Recession Odds Hit 55% According to Deutsche Bank Model (mishtalk.com).
That Time I Went To A Trump Rally (storify.com). Berntards, listen up!
44 Percent of Democrats Want Sanders to Make an Independent Run for the White House (defenddemocracy.press).
Chin Up (carlbeijer.com).
❉
![]() |
Friday, June 10, 2016
Friday Water Cooler
The False Promise of DNA Testing (theatlantic.com). "One recent study asked participants to shake hands with a partner for two minutes and then hold a knife; when the DNA on the knives was analyzed, the partner was identified as a contributor in 85 percent of cases, and in 20 percent as the main or sole contributor."
Mystery girl in Calif. gets second funeral, 145 years after she was first buried (WaPo).
Scotland Bans Fracking, Forever (oilprice.com).
India Records Its Highest Temperature Ever (CNN).
Internet Boom Times Are Over (bloomberg.com). Internet growth is flat worldwide.
"Noncoding" RNA molecules create micropeptides (sott.net). Someone now needs to continue this work with pseudogenes (many of which, we know, are transcribed to RNA) and see how many are associated with biologically active oligopeptides. Many bacterial pathogens have abnormally large numbers of pseudogenes, which tend (paradoxically) to be highly conserved, evolutionarily. Most pseudogenes are millions of years old. Why? Maybe because they are making useful products.
I Had to Leave the U.S. to Stop Pretending to Be an Extrovert (alternet.org). An ad copywriter tells how his introverted personality, a liability in the U.S., freed him in Switzerland.
L.A. County Is Proposing To Tax Millionaires In Order To End Homelessness (laist.com).
California newspaper endorses Reagan for president (cnn.com).
Twenty Thousand Commit To Anti-Hillary ‘Occupy DNC’ Protest (dailycaller.com).
Trump Leads Clinton on Top-Ranking Economic Issues (gallup.com). Gallup poll finds people prefer Trump over Clinton 53% to 43% on economic matters.
8 Quick Thoughts on the Emmett Rensin Suspension (coreyrobin.com). Newsflash: You can get fired for writing things that piss off your boss! Funny how political writers (specialists in writing about power!) don't seem to understand this. Look: If you write about raw power (politics) for a living, how can you claim to be confused or outraged when a boss fires someone (an exercise of raw power) for rocking the boat? Do you not understand how power works? Yes. it's ugly, yes, it's wrong; we get that. But this is your domain of expertise, if you're a political writer. Act like you know what you're writing about.
Art world is 'hotbed' of corruption, collector claims (telegraph.co.uk). Delete the word "art." There, fixed it.
"Welfare to work" didn't work for these women (slate.com). Welcome to Clintonomics 101. Take a Dixie cup and sit yo broke ass down.
Meaningful work not created, only destroyed, by bosses, study finds (sciencedaily.com).
Worldwide Alcohol Consumption Went Down Last Year—Except in the United States (alternet.org). Cheers!
Thanks for visiting. Be sure to check out prior weeks' Water Coolers (see links at right).
Many, many thanks to the fine folks (below) who retweeted me recently on "the Twitter." Follow these tweeps. They retweet!
Buy my books (or at least click for more info):
Mystery girl in Calif. gets second funeral, 145 years after she was first buried (WaPo).
Scotland Bans Fracking, Forever (oilprice.com).
India Records Its Highest Temperature Ever (CNN).
Internet Boom Times Are Over (bloomberg.com). Internet growth is flat worldwide.
"Noncoding" RNA molecules create micropeptides (sott.net). Someone now needs to continue this work with pseudogenes (many of which, we know, are transcribed to RNA) and see how many are associated with biologically active oligopeptides. Many bacterial pathogens have abnormally large numbers of pseudogenes, which tend (paradoxically) to be highly conserved, evolutionarily. Most pseudogenes are millions of years old. Why? Maybe because they are making useful products.
I Had to Leave the U.S. to Stop Pretending to Be an Extrovert (alternet.org). An ad copywriter tells how his introverted personality, a liability in the U.S., freed him in Switzerland.
L.A. County Is Proposing To Tax Millionaires In Order To End Homelessness (laist.com).
California newspaper endorses Reagan for president (cnn.com).
Twenty Thousand Commit To Anti-Hillary ‘Occupy DNC’ Protest (dailycaller.com).
Trump Leads Clinton on Top-Ranking Economic Issues (gallup.com). Gallup poll finds people prefer Trump over Clinton 53% to 43% on economic matters.
8 Quick Thoughts on the Emmett Rensin Suspension (coreyrobin.com). Newsflash: You can get fired for writing things that piss off your boss! Funny how political writers (specialists in writing about power!) don't seem to understand this. Look: If you write about raw power (politics) for a living, how can you claim to be confused or outraged when a boss fires someone (an exercise of raw power) for rocking the boat? Do you not understand how power works? Yes. it's ugly, yes, it's wrong; we get that. But this is your domain of expertise, if you're a political writer. Act like you know what you're writing about.
Art world is 'hotbed' of corruption, collector claims (telegraph.co.uk). Delete the word "art." There, fixed it.
"Welfare to work" didn't work for these women (slate.com). Welcome to Clintonomics 101. Take a Dixie cup and sit yo broke ass down.
Meaningful work not created, only destroyed, by bosses, study finds (sciencedaily.com).
Worldwide Alcohol Consumption Went Down Last Year—Except in the United States (alternet.org). Cheers!
Thanks for visiting. Be sure to check out prior weeks' Water Coolers (see links at right).
❉
Many, many thanks to the fine folks (below) who retweeted me recently on "the Twitter." Follow these tweeps. They retweet!
Buy my books (or at least click for more info):
![]() |
Subscribe to:
Posts (Atom)



